Discover Eckher Semantic Web Browser: "http://xmlns.com/foaf/0.1/Person", "http://schema.org/Organization", "http://www.w3.org/2004/02/skos/core#definition", "http://www.wikidata.org/entity/Q1".

Discover English pronunciations: "Olaf Scholz", "Karl Nehammer", "Alexander Schallenberg", "omicron", "Dimitrescu", "DOGE", "fatale", "Dogecoin", "Niçoise", "Nahum", "Oisín", "cheugy", "bamlanivimab".

Create sequence logos for protein and DNA/RNA alignments using Eckher Sequence Logo Maker.

Compose speech audio from IPA phonetic transcriptions using Eckher IPA to Speech.

Browse place name pronunciation on Eckher IPA Map.

Enter IPA characters using Eckher IPA Keyboard.

Navigate the Semantic Web and retrieve the structured data about entities published on the web using Eckher Semantic Web Browser.

Turn your phone into a compass using Eckher Compass.

Browse word pronunciations online using Eckher Dictionary.

Author, enrich, and query structured data using Eckher Database for RDF.

Create TeX-style mathematical formulas online with Eckher Math Editor.

Create knowledge graphs using Eckher RDF Graph Editor.

Send messages and make P2P calls using Eckher Messenger.

Build event-sourced systems using Eckher Database for Event Sourcing.

View PDB files online using Eckher Mol Viewer.

Listen to your text using Eckher Text to Speech.

View FASTA sequence alignments online with Eckher Sequence Alignment Viewer.

Convert Punycode-encoded internationalized domain names (IDNs) to Unicode and back with Eckher Punycode Converter.

Explore the human genome online with Eckher Genome Browser.

Edit text files online with Eckher Simple Text Editor.

Send test emails with Eckher SMTP Testing Tool.

Разбор слов по составу: "заметный", "сильнее", "беспрестанно", "грустно", "перерыв", "неряшливо", "крикливость", "невозможно", "наушник", "тихо".

What do you call a person from Barbados?

What do you call a person from New Zealand?

What do you call a person from Niger?

What do you call a person from Switzerland?

What do you call a person from Finland?

What do you call a person from Denmark?

Розбір слів за будовою: "ходити", "батько".

Разбор слоў па саставе: "рассыпаць", "крычаць", "засеяць", "асенні", "адбіраць", "ісці".

Ударения в словах: "Шеншин", "мальбек", "хуцпа", "начав", "Майкоп".

Синонимы к словам: "потешить", "подхалимство", "хтонь", "тужить", "неблагоприятный", "непостоянный".

Антонимы к словам: "сжать", "демпинг", "этатизм", "иллюзия".

ATGCTGAGTAGGAGTGCAGC

Your sequences are your genetic makeup.

Your genetics—is what makes you, you.

Discover My Sequences

Store and organize your genetic information

Whole genome records

The complete DNA sequence of your genome

Exome sequences

Protein-coding regions of the genome

Transcriptome snapshots

Snapshots of the changing cellular transcriptome

Microarray data

Expression levels of large numbers of genes

Microbiome profiles

Samples of all genes in microbial communities

3D molecular structures

Atomic structures of proteins and other macromolecules

Get insights from your data

Get to know yourself better

My Sequences provides you with everything you can learn from your DNA—from your ancestry to how you respond to certain drugs.

Every day, we review the latest research and use state-of-the-art in silico methods to better predict your clinical outcomes.

You and your data are always safe and secure

With My Sequences

HIPAA-compliant storage

My Sequences' cloud infrastructure allows you to securely store, analyze, and gain insights from your genetic information. Your data is safe both at rest and in transit.

Mandatory 2-step authentication

Use the My Sequences Security Key devices to log in. After you've enrolled, you can also add the built-in security key on a compatible phone.

Enroll in 3-Step Protection

To add an extra layer of security to your information, you can choose to further encrypt your data and only have it interpreted and analyzed on your computer.

Our genetic counselors can answer all your questions

My Sequences helps you navigate the age of the genome, yet there is still a lot to consider with genetic testing.

As a My Sequences customer, you can speak with our genetic counselors who are here to help you make an informed choice.

Join the My Sequences Early Access Program

Become one of the first My Sequences customers and get exclusive access to the pre-release features.